Boosted by @GroupNebula563@mastodon.social
the pooltoy furries don't want you to realise this, but even the dummy thick ones weigh like 5kg of plastic max and you can just duct tape them to the wall if they're being rowdy
Remote
Pulchra 
@Nerts@yiff.life
mastodon 4.8.0-alpha.3+glitchHi I'm Frankie
Follow me to see me yell about furry stuff and RPGs mostly
it/that/its ✨
0 Followers
848 Following
50 Posts
Joined August 16, 2018
Cohost (rip):
Bluesky (begrudgingly):
Discord:
fffwankie
a lot of people think driving is PvP, but it's actually co-op, the player base is just extremely toxic
Boosted by @GroupNebula563@mastodon.social
I've spent years trying to tell the cis guys I know that simpsons and futurama quotes are a very poor way to flirt to no results
Replying to
sharks in this having +30% attack and not wearing armour is lore accurate to all the shark furries I know
there's really people out there spending 300+USD on a keyboard with no numpad
seeing an article about amazon investing in renewables and reducing carbon use
glancing out my window at one of their rusty ass diesel vans parked with the engine left running two doors down the street
[ate three burritos and is feeling unwell voice]: wolf is a verb
Boosted by @GroupNebula563@mastodon.social
Replying to
hello my name is Hugh Mann and I enjoy phonecalls, TV, and instant coffee
Boosted by @GroupNebula563@mastodon.social
fucked up that valve used AI and a time machine for Zoey's hands like that
Boosted by @GroupNebula563@mastodon.social
thinking about that one meme that goes "Spongebob me boy, I've had me genome sequenced! ACTGACTGACTGACTGACTGACTGACTGACTG"
🐝
Dino Crisis would've been greatly improved and made slightly baffling if Regina was a shark
Commands for Gamers
advantages of very tall fursona: people can't tell if you're looking at them or looking at their cleavage
Boosted by @GroupNebula563@mastodon.social
Wrath and Glory time
I am using the marine as a distraction as he struggles to operate a touchscreen vending machine to simply shoplift things instead
feeling like the Zap Branigan "Now here's a plan with some chest hair!" bit talking to someone else also GMing a Cyberpunk game because they're having their players fight 5 hired goons who have pistols and sporting equipment, and I'm putting mine up against several armoured vehicles
fursonae
fursoña
Replying to
taking me back to the good ol' days of hacks being about putting [h1]you'f been epically pwned[/h1] on people's screens and then bricking their system for kicks instead of deploying ransomware and hijacking crypto wallets
realising that a bunch of old cyberpunk stuff is having their titles become more hackery sounding once again because no one knows how a file directory works any more
all of the americans logging on in the evening to see what words in what order pour out of me during a 2am caffeine crash
Thinking about a pic I saw of a dog girl with big bappy paws wearing a shirt that said "I ♥️ femboys"
thinking about her kneeling over one of my femboy characters, sitting on the back of their head and forcing them face down into thick, chunky padded toes, to be specific
Replying to
ok we're up to 2, one drive works in my desktop but not this laptop for some reason so I had to swap SSDs around
anyway I think we should incinerate every laptop manufacturer
does anyone have that meme of a painting of two rollercoaster cars, one full of scared people and one full of zombies, labeled "people getting up at 6am" and "people still up at 6am"?
it's always interesting to come across something that "everyone knows" that someone doesn't
you know, they're probably working on concepts for the 69th warframe at the moment
I should probably change my display name now that the neopets TTRPG is completely dead
@LB, I have found jars in the back of cupboards that had been further past their date than the duration of the confederacy
Hear.. feel... twink...
Boosted by @GroupNebula563@mastodon.social
important things about Tachi from metal cardbot:
big kitty
60% legs
keeps bending forward to get low enough to talk to human characters
keeps doing crouched sprint starts
exposed ball joint hips
immense thighs
an important thing to keep in mind about how over the top a lot of warframe build theorycrafting is, is that they're ally seething about their build being worse than rumblejack w/random bullshit mods + melee influence + going 40 minutes deep on survival as Koumei
Boosted by @GroupNebula563@mastodon.social
Kids these days have to play video games to get a "Weird Route", back in my day we didn't have GPS so any time you went out of town w-[dragged off stage via crook]
Boosted by @GroupNebula563@mastodon.social
happy non-binary day, my pizza is 30 minutes late and counting